Top » Catalog » SNPs » A10221

$18.00

A10221
[A10221]

A10221
HG19 Position: ChrY:7328741..7328741
Ancestral: A
Derived: C
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10221_F GATTGGGAGAAGGTATCCCTATAAG
Reverse Primer: A10221_R GGGAGAAAGTTTGTATCTTTGTGTG
Reviews

Customers who bought this product also purchased
A10222
A10222
A10227
A10227
A10226
A10226
A10225
A10225
A10224
A10224
A10229
A10229
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies