Top » Catalog » SNPs » A10222

$17.50

A10222
[A10222]

A10222
HG19 Position: ChrY:7772272..7772272
Ancestral: C
Derived: T
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10222_F CCTCTGCTTCAAAAAGCTGG
Reverse Primer: A10222_R GGATGACAACCCCAATTCAG
Reviews

Customers who bought this product also purchased
A10223
A10223
A10228
A10228
A10221
A10221
A10227
A10227
A10226
A10226
A10225
A10225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies