Top » Catalog » SNPs » A10222

$18.00

A10222
[A10222]

A10222
hg38 Position: ChrY:7904231..7904231
Ancestral: C
Derived: T
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10222_F CCTCTGCTTCAAAAAGCTGG
Reverse Primer: A10222_R GGATGACAACCCCAATTCAG
Reviews

Customers who bought this product also purchased
A10224
A10224
A10229
A10229
A10223
A10223
A10228
A10228
A10221
A10221
A10227
A10227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies