Top » Catalog » SNPs » A10223

$18.00

A10223
[A10223]

A10223
hg38 Position: ChrY:13637723..13637723
Ancestral: C
Derived: A
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10223_F CAGAAGAAACCAATTCCAGAAAG
Reverse Primer: A10223_R GTCGTGTTTATCTCCCTAGAAAGC
Reviews

Customers who bought this product also purchased
A10222
A10222
A10228
A10228
A10221
A10221
A10227
A10227
A10226
A10226
A10225
A10225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies