Top » Catalog » SNPs » A10224

$18.00

A10224
[A10224]

A10224
hg38 Position: ChrY:15452647..15452647
Ancestral: T
Derived: G
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10224_F TAGCCATGCAACAAGTGAGG
Reverse Primer: A10224_R GGACAGGAAAGATTCAGTTGG
Reviews

Customers who bought this product also purchased
A10225
A10225
A10223
A10223
A10229
A10229
A10222
A10222
A10228
A10228
A10221
A10221
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies