Top » Catalog » SNPs » A10225

$18.00

A10225
[A10225]

A10225
hg38 Position: ChrY:16025577..16025577
Ancestral: G
Derived: C
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10225_F AAGGTAGTGGGCTAGAGCTTTG
Reverse Primer: A10225_R TCTCCACACGTCAAGAGCAG
Reviews

Customers who bought this product also purchased
A10229
A10229
A10222
A10222
A10228
A10228
A10221
A10221
A10227
A10227
A10226
A10226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies