Top » Catalog » SNPs » A10227

$18.00

A10227
[A10227]

A10227
hg38 Position: ChrY:19402875..19402875
Ancestral: T
Derived: A
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10227_F GGTAAACGCACATCATGAAATG
Reverse Primer: A10227_R TGCTTCATGGAAAAATTTAGGG
Reviews

Customers who bought this product also purchased
A10221
A10221
A10226
A10226
A10225
A10225
A10224
A10224
A10223
A10223
A10229
A10229
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies