Top » Catalog » SNPs » A10229

$18.00

A10229
[A10229]

A10229
hg38 Position: ChrY:21378715..21378715
Ancestral: A
Derived: G
Reference: Tony Popish (2016)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: A10229_F TTGTGGTAAAGGCAAATACTGG
Reverse Primer: A10229_R AGATACAAAACACAAATGGGATACAG
Reviews

Customers who bought this product also purchased
A10224
A10224
A10223
A10223
A10228
A10228
A10222
A10222
A10227
A10227
A10221
A10221
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies