Top » Catalog » SNPs » A10231

$18.00

A10231
[A10231]

A10231
HG19 Position: ChrY:14805518..14805518
Ancestral: G
Derived: A
Reference:
ISOGG Haplogroup:
Comments: .
Forward Primer: A10231_F ATGCTACCTGCCACAAGAGG
Reverse Primer: A10231_R CTGGTCCTGGATGAAATTCG
Reviews

Customers who bought this product also purchased
FGC41767
FGC41767
FGC37130
FGC37130
Z11005
Z11005
FGC37037
FGC37037
FGC42304
FGC42304
FGC36924
FGC36924
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies