Top » Catalog » SNPs » A10231

$18.00

A10231
[A10231]

A10231
hg38 Position: ChrY:12693589..12693589
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: A10231_F ATGCTACCTGCCACAAGAGG
Reverse Primer: A10231_R CTGGTCCTGGATGAAATTCG
Reviews

Customers who bought this product also purchased
FGC41768
FGC41768
FGC36923
FGC36923
FGC41767
FGC41767
FGC37130
FGC37130
Z11005
Z11005
FGC37037
FGC37037
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies