Top » Catalog » SNPs » A10233

$18.00

A10233
[A10233]

A10233
hg38 Position: ChrY:15059803..15059803
Ancestral: A
Derived: C
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10233_F ATTTAGATGCTTGCTGGAGTCAG
Reverse Primer: A10233_R CAAAGGGTTAGGGAAGACAGG
Reviews

Customers who bought this product also purchased
Z9
Z9
Z8172
Z8172
L47
L47
Z326
Z326
R1b-L48 Panel
R1b-L48 Panel
Z331
Z331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS389I+II
1 x DYS462
$24.95
Haplogroup Info
Other products
Currencies