Top » Catalog » SNPs » A10235

$18.00

A10235
[A10235]

A10235
HG19 Position: ChrY:9331207..9331207
Ancestral: C
Derived: T
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10235_F GGCTGCCGTTATGAAAAGATATC
Reverse Primer: A10235_R GATTACCTAGCTCCTGGATGATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1105
1 x A10652
1 x A10312
1 x A10685
$72.00
Haplogroup Info
Other products
Currencies