Top » Catalog » SNPs » A10236

$17.50

A10236
[A10236]

A10236
HG19 Position: ChrY:7557540..7557540
Ancestral: T
Derived: C
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10236_F CTCCGCCATTATGTCATCC
Reverse Primer: A10236_R GCCTGCCTAATGAAGTGAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies