Top » Catalog » SNPs » A10237

$18.00

A10237
[A10237]

A10237
HG19 Position: ChrY:22805413..22805413
Ancestral: C
Derived: T
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10237_F CTTGCCCTGCTTCTCCCTAC
Reverse Primer: A10237_R CTTGCACCACTCCAATGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies