Top » Catalog » SNPs » A10240

$18.00

A10240
[A10240]

A10240
hg38 Position: ChrY:7398809..7398809
Ancestral: G
Derived: T
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10240_F AATTTGAGTGGCCGAAAAAG
Reverse Primer: A10240_R TGCAGAAACCTTGTGTGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies