Top » Catalog » SNPs » A10243

$18.00

A10243
[A10243]

A10243
HG19 Position: ChrY:19050325..19050325
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10243_F CAGGGAAAACAGGCAGACTC
Reverse Primer: A10243_R GGTGGAAGGATCATTTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10999
1 x A11746
1 x A10113
1 x A11687
1 x A10589
1 x A11649
1 x A1073
1 x A10922
1 x A10852
1 x A11367
$180.00
Haplogroup Info
Other products
Currencies