Top » Catalog » SNPs » A10283

$17.50

A10283
[A10283]

A10283
HG19 Position: ChrY:14667652..14667652
Ancestral: G
Derived: C
Reference: George Chandler (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10283_F TGTGGAACCAACATTGTAAACC
Reverse Primer: A10283_R TGTGGGTCCTCTCAGGATTC
Reviews

Customers who bought this product also purchased
FGC23134
FGC23134
A10284
A10284
A10282
A10282
FGC23143
FGC23143
FGC23141
FGC23141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies