Top » Catalog » SNPs » A10292

$18.00

A10292
[A10292]

A10292
HG19 Position: ChrY:13884259..13884259
Ancestral: C
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10292_F GCATTCAGGAGACTCCTAGTGG
Reverse Primer: A10292_R GATATCTTCACTATTGACCATGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10723
1 x A11063
1 x A10740
1 x A10150
$72.00
Haplogroup Info
Other products
Currencies