Top » Catalog » SNPs » A10293

$18.00

A10293
[A10293]

A10293
HG19 Position: ChrY:20755245..20755245
Ancestral: A
Derived: G
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10293_F AAGCCAGGAGGTGTAGGTTG
Reverse Primer: A10293_R TTCGGACATAGGCGTAAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11539
1 x A1019
1 x A10938
1 x A1162
1 x A10248
$90.00
Haplogroup Info
Other products
Currencies