Top » Catalog » SNPs » A10295

$18.00

A10295
[A10295]

A10295
HG19 Position: ChrY:11925179..11925179
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10295_F GGAAGCTGGAAATGAAGTTTCC
Reverse Primer: A10295_R CCCCTTAATCACAAGTACAAGTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10028
1 x A10684
1 x A11433
$54.00
Haplogroup Info
Other products
Currencies