Top » Catalog » SNPs » A10298

$18.00

A10298
[A10298]

A10298
hg38 Position: ChrY:20501733..20501733
Ancestral: G
Derived: C
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10298_F TCAGGGCTGGATTCAAAAAC
Reverse Primer: A10298_R CAATGGGGCAAAACAACTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies