Top » Catalog » SNPs » A10301

$18.00

A10301
[A10301]

A10301
HG19 Position: ChrY:7931017..7931017
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10301_F CTGTGTCCTGTGATATGTCATAAGTC
Reverse Primer: A10301_R CAGGTAATGTTACATCCTTACTTGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10995
1 x A10672
$36.00
Haplogroup Info
Other products
Currencies