Top » Catalog » SNPs » A10303

$18.00

A10303
[A10303]

A10303
HG19 Position: ChrY:15396909..15396909
Ancestral: T
Derived: C
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10303_F GCATAAAGCGCTTATGAAGAGAC
Reverse Primer: A10303_R CTGCTGTGAAGGGCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10926
1 x A10111
1 x A11627
1 x A10120
1 x A10526
1 x A10028
$108.00
Haplogroup Info
Other products
Currencies