Top » Catalog » SNPs » A10305

$18.00

A10305
[A10305]

A10305
HG19 Position: ChrY:20315218..20315218
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10305_F TAAAGGTGTTATTTCCATTGTTTGC
Reverse Primer: A10305_R GAAGGAACAAACTCTGGACATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10678
1 x A11103
1 x A10391
1 x A10592
1 x A10108
1 x A11462
1 x A11536
1 x A11370
$144.00
Haplogroup Info
Other products
Currencies