Top » Catalog » SNPs » A10306

$18.00

A10306
[A10306]

A10306
HG19 Position: ChrY:12872926..12872926
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10306_F CTCCTGACCTTGTGATACGATG
Reverse Primer: A10306_R AGCTGATCTGCTCACCTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies