Top » Catalog » SNPs » A10310

$17.50

A10310
[A10310]

A10310
HG19 Position: ChrY:18137850..18137850
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10310_F GAAAGAGGTTTAGTGGGCTCAC
Reverse Primer: A10310_R AGGACTTGTAGTTTCATTCCTCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies