Top » Catalog » SNPs » A10313

$18.00

A10313
[A10313]

A10313
HG19 Position: ChrY:8520418..8520418
Ancestral: G
Derived: T
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10313_F GGAAAATGGTATCCCAGCAC
Reverse Primer: A10313_R GGCTGTGGCACTGGACTC
Reviews

Customers who bought this product also purchased
A10315
A10315
A10314
A10314
A10312
A10312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies