Top » Catalog » SNPs » U1

$18.00

U1
[U1]

U1
hg38 Position: ChrY:12946970..12946970
Ancestral: A
Derived: G
Reference: Sims et al 2009
ISOGG Haplogroup: G2a2b2a1a1a
Comments: Downstream of P303. upstream of L13. parallel to L42 and L139
Forward Primer: U1_F ACTGTGGGTCTCCTGGAGTG
Reverse Primer: U1_R CCTGCTTTTCAACTCAACAGG
Reviews

Customers who bought this product also purchased
Z29424
Z29424
L1263
L1263
S9751
S9751
BY45254
BY45254
Z30781
Z30781
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies