Top » Catalog » SNPs » A10505

$17.50

A10505
[A10505]

A10505
HG19 Position: ChrY:8356367..8356367
Ancestral: G
Derived: A
Reference: William Kidd (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A10505_F TTCGTTATTTCTATGGTTTACAACAAC
Reverse Primer: A10505_R GAAATAAAAGCTCAACAAGTTACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies