Top » Catalog » Y SNPs » M5043

$18.00

M5043
[M5043]

M5043
hg38 Position: ChrY:19388594..19388594
Ancestral: C
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: M5043_F TTGGTCTGTTCAGGTTTTGG
Reverse Primer: M5043_R GAGAAAGCAAGCACCTTTGC
Reviews (2)

Customers who bought this product also purchased
M5302
M5302
Z21386
Z21386
Y264872
Y264872
L283
L283
BY10246
BY10246
FT106022
FT106022
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies