Top » Catalog » SNPs » M5043

$18.00

M5043
[M5043]

M5043
hg38 Position: ChrY:19388594..19388594
Ancestral: C
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: E1b1 (not listed)
Comments: .
Forward Primer: M5043_F TTGGTCTGTTCAGGTTTTGG
Reverse Primer: M5043_R GAGAAAGCAAGCACCTTTGC
Reviews (2)

Customers who bought this product also purchased
MZ101
MZ101
FT97858
FT97858
S17250
S17250
BY8929
BY8929
BY8901
BY8901
BY8920
BY8920
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies