Top » Catalog » SNPs » A10506

$17.50

A10506
[A10506]

A10506
HG19 Position: ChrY:22619163..22619163
Ancestral: C
Derived: G
Reference: William Milliken (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of M222_A223_A823_A982
Forward Primer: A10506_F CTGACTCAGAAGCTAGTGCCTG
Reverse Primer: A10506_R CATAGATGGGAATTGAACATTGC
Reviews

Customers who bought this product also purchased
A10509
A10509
A10508
A10508
A10511
A10511
A10510
A10510
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies