Top » Catalog » SNPs » A10506

$18.00

A10506
[A10506]

A10506
HG19 Position: ChrY:20457277..20457277
Ancestral: C
Derived: G
Reference: William Milliken (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of M222_A223_A823_A982
Forward Primer: A10506v2_F TTTCTTGGCAAAACCATGC
Reverse Primer: A10506v2_R GCATAGGAGATATACCTAATGTAAATGACC
Reviews

Customers who bought this product also purchased
A10508
A10508
A10511
A10511
A10510
A10510
A10509
A10509
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11099
1 x A10600
1 x A10325
1 x A11289
1 x A10161
1 x A11538
1 x A11092
1 x A11366
$144.00
Haplogroup Info
Other products
Currencies