Top » Catalog » SNPs » A10510

$18.00

A10510
[A10510]

A10510
HG19 Position: ChrY:16547517..16547517
Ancestral: C
Derived: T
Reference: William Milliken (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of M222_A223_A823_A982
Forward Primer: A10510_F ACACAGCTTGGCTTTGTGC
Reverse Primer: A10510_R AAGGCCTCTTCAACCATCTG
Reviews

Customers who bought this product also purchased
A10511
A10511
A10509
A10509
A10508
A10508
A10506
A10506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1000
$18.00
Haplogroup Info
Other products
Currencies