Top » Catalog » SNPs » A10317

$17.50

A10317
[A10317]

A10317
HG19 Position: ChrY:7273957..7273957
Ancestral: G
Derived: T
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10317_F AGAGTAAGCCCTATCAACAGCTAAG
Reverse Primer: A10317_R GCTGCTTATTGGTGCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies