Top » Catalog » SNPs » A10322

$18.00

A10322
[A10322]

A10322
HG19 Position: ChrY:13344478..13344478
Ancestral: T
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10322_F CCAGAAGCAATAGCCACCC
Reverse Primer: A10322_R GCAGTCCAAATCTAGGAATAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10737
1 x A10680
1 x A101
1 x A1150
$72.00
Haplogroup Info
Other products
Currencies