Top » Catalog » SNPs » A10323

$18.00

A10323
[A10323]

A10323
hg38 Position: ChrY:19656381..19656381
Ancestral: T
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10323_F GTGGGTTTGTCATAGATGGCTC
Reverse Primer: A10323_R AGAAACACAGCAAGCGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies