Top » Catalog » SNPs » A10324

$18.00

A10324
[A10324]

A10324
HG19 Position: ChrY:19692535..19692535
Ancestral: A
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10324_F TCAAAGGGGTCTTCTAGGTAAGG
Reverse Primer: A10324_R TGGGTATCCACTAAGGAGTTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11509
1 x A11077
1 x A10884
1 x A10674
1 x A10893
$90.00
Haplogroup Info
Other products
Currencies