Top » Catalog » SNPs » A10324

$18.00

A10324
[A10324]

A10324
HG19 Position: ChrY:19692535..19692535
Ancestral: A
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10324_F TCAAAGGGGTCTTCTAGGTAAGG
Reverse Primer: A10324_R TGGGTATCCACTAAGGAGTTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11473
1 x A10284
1 x A10228
1 x A10329
1 x A10748
1 x A10875
1 x A10287
1 x A11448
1 x A11685
1 x A10984
1 x A109
1 x A10144
$216.00
Haplogroup Info
Other products
Currencies