Top » Catalog » SNPs » A10512

$18.00

A10512
[A10512]

A10512
HG19 Position: ChrY:2785478..2785478
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream FGC7174/Y3730
Forward Primer: A10512_F ACCAACAGCACAGCAATGAG
Reverse Primer: A10512_R TCTCCTAGACTCGCCTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11054
1 x A10809
1 x A10001
1 x A10222
1 x A11094
1 x A10986
1 x A11552
$126.00
Haplogroup Info
Other products
Currencies