Top » Catalog » SNPs » A10513

$18.00

A10513
[A10513]

A10513
HG19 Position: ChrY:16856252..16856252
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2016)
ISOGG Haplogroup: I2
Comments: Downstream FGC7174/Y3730
Forward Primer: A10513_F GTTGAGGATACTTTTAGTTTTATATTCATGC
Reverse Primer: A10513_R ACAGCTGACACATGTACTGTTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies