Top » Catalog » SNPs » Z5009

$18.00

Z5009
[Z5009]

Z5009
hg38 Position: ChrY:14583866..14583866
Ancestral: G
Derived: A
Reference: Greg Magoon et al.
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Downstream M183
Forward Primer: Z5009_F CTCAGCTAGGTTGCCTCCTC
Reverse Primer: Z5009_R GGCCATCTCTCTCTGGTGAC
Reviews

Customers who bought this product also purchased
MZ101
MZ101
BY8974
BY8974
Y128659
Y128659
FT277366
FT277366
FT391953
FT391953
FT133722
FT133722
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies