Top » Catalog » SNPs » A10517

$17.50

A10517
[A10517]

A10517
HG19 Position: ChrY:23257968..23257968
Ancestral: G
Derived: T
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10517_F AGGGCCCTTTTAGGGATTG
Reverse Primer: A10517_R AGGCCCACTAGTGTGAAAATG
Reviews

Customers who bought this product also purchased
A10516
A10516
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies