Top » Catalog » SNPs » A10288

$18.00

A10288
[A10288]

A10288
HG19 Position: ChrY:8373334..8373334
Ancestral: T
Derived: A
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF27
Forward Primer: A10288_F CATGAGATTATCCCAAGCCATAG
Reverse Primer: A10288_R TGTGCAACACAAAATGTATTTGG
Reviews

Customers who bought this product also purchased
A10291
A10291
A10290
A10290
A10289
A10289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies