Top » Catalog » SNPs » A10289

$18.00

A10289
[A10289]

A10289
HG19 Position: ChrY:9311382..9311382
Ancestral: G
Derived: A
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF27
Forward Primer: A10289v2_F TGGTATGCAATAACTATTATTTTGAACC
Reverse Primer: A10289v2_R CTTCTGACTGTTGAAGACTTGATTAATG
Reviews

Customers who bought this product also purchased
A10291
A10291
A10290
A10290
A10288
A10288
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10936
1 x A10519
1 x A10891
1 x A10499
1 x A11246
1 x A11727
$108.00
Haplogroup Info
Other products
Currencies