Top » Catalog » SNPs » A10526

$18.00

A10526
[A10526]

A10526
hg38 Position: ChrY:6751994..6751994
Ancestral: C
Derived: T
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10526v2_F TCAGGTTCTGTCTTTCAGCTGTAC
Reverse Primer: A10526v2_R AAGTGGACTCCCAGCAAGAC
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS439
DYS439
A12583
A12583
Y23074
Y23074
A11215
A11215
Y23073
Y23073
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies