Top » Catalog » SNPs » A10526

$17.50

A10526
[A10526]

A10526
HG19 Position: ChrY:6620035..6620035
Ancestral: C
Derived: T
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10526_F TTCTCAGGTTCTGTCTTTCAGC
Reverse Primer: A10526_R CCTATGTAGAGGGGCCTGAC
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS439
DYS439
Y22116
Y22116
DYS390
DYS390
A12584
A12584
Y23075
Y23075
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies