Top » Catalog » SNPs » A10526

$18.00

A10526
[A10526]

A10526
HG19 Position: ChrY:6751994..6751994
Ancestral: C
Derived: T
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10526v2_F TCAGGTTCTGTCTTTCAGCTGTAC
Reverse Primer: A10526v2_R AAGTGGACTCCCAGCAAGAC
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS439
DYS439
Y23073
Y23073
DYS607
DYS607
R1b-A10526 John-Cryans-Lindsey Panel
R1b-A10526 John-Cryans-Lindsey Panel
Y22118
Y22118
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1133
1 x A10874
$36.00
Haplogroup Info
Other products
Currencies