Top » Catalog » SNPs » A10527

$18.00

A10527
[A10527]

A10527
hg38 Position: ChrY:7441009..7441009
Ancestral: A
Derived: G
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10527_F CATTTATCCATCAGATAATCATAGGTG
Reverse Primer: A10527_R GGCTCTCATCTTATAAAATTCCCAG
Reviews

Customers who bought this product also purchased
A2501
A2501
Z39589
Z39589
FGC4133
FGC4133
FGC46309
FGC46309
DF49
DF49
A259
A259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies