Top » Catalog » SNPs » A10528

$18.00

A10528
[A10528]

A10528
hg38 Position: ChrY:8221698..8221698
Ancestral: A
Derived: C
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10528v2_F CCACTGCTTGTCCCTACAGTC
Reverse Primer: A10528v2_R GTATTTTTTGTTTGTTTTGGGTGAC
Reviews

Customers who bought this product also purchased
FGC23742
FGC23742
FGC32795
FGC32795
FGC32796
FGC32796
DNA Sample Kit
DNA Sample Kit
A10642
A10642
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies