Top » Catalog » SNPs » A10528

$18.00

A10528
[A10528]

A10528
HG19 Position: ChrY:8089739..8089739
Ancestral: A
Derived: C
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10528_F AAGCACACTTTTCACTTACTTTACATATG
Reverse Primer: A10528_R ATGCCATTCGTGTACACAGAAC
Reviews

Customers who bought this product also purchased
A10642
A10642
FGC23742
FGC23742
FGC32795
FGC32795
FGC32796
FGC32796
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies