Top » Catalog » SNPs » A10528

$17.50

A10528
[A10528]

A10528
HG19 Position: ChrY:8089739..8089739
Ancestral: A
Derived: C
Reference: Richard John (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF49 > S474
Forward Primer: A10528_F AAGCACACTTTTCACTTACTTTACATATG
Reverse Primer: A10528_R ATGCCATTCGTGTACACAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies